|
Addgene inc
435 ybbr strep houlard 435 Ybbr Strep Houlard, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/435 ybbr strep houlard/product/Addgene inc Average 93 stars, based on 1 article reviews
435 ybbr strep houlard - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pcr Pcr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr/product/Addgene inc Average 91 stars, based on 1 article reviews
pcr - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
|
Addgene inc
stains neurotrace 435 55 nissl stain invitrogen ![]() Stains Neurotrace 435 55 Nissl Stain Invitrogen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stains neurotrace 435 55 nissl stain invitrogen/product/Addgene inc Average 93 stars, based on 1 article reviews
stains neurotrace 435 55 nissl stain invitrogen - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
prdx3 plasmid ![]() Prdx3 Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prdx3 plasmid/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
prdx3 plasmid - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
trcn0000173273 ttgggaagcttatagtggagg ![]() Trcn0000173273 Ttgggaagcttatagtggagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trcn0000173273 ttgggaagcttatagtggagg/product/Addgene inc Average 90 stars, based on 1 article reviews
trcn0000173273 ttgggaagcttatagtggagg - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
popins arel1 ![]() Popins Arel1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/popins arel1/product/Addgene inc Average 93 stars, based on 1 article reviews
popins arel1 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
aav5 hsyn dio hm3d gq mcherry ![]() Aav5 Hsyn Dio Hm3d Gq Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav5 hsyn dio hm3d gq mcherry/product/Addgene inc Average 92 stars, based on 1 article reviews
aav5 hsyn dio hm3d gq mcherry - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Addgene inc
aav8 dio hsyn hm4di mcherry ![]() Aav8 Dio Hsyn Hm4di Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8 dio hsyn hm4di mcherry/product/Addgene inc Average 90 stars, based on 1 article reviews
aav8 dio hsyn hm4di mcherry - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
ggct 3 ![]() Ggct 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ggct 3/product/Addgene inc Average 90 stars, based on 1 article reviews
ggct 3 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
mouse c myc ![]() Mouse C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse c myc/product/Addgene inc Average 90 stars, based on 1 article reviews
mouse c myc - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
synapsin yfp navii iii construct ![]() Synapsin Yfp Navii Iii Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synapsin yfp navii iii construct/product/Addgene inc Average 92 stars, based on 1 article reviews
synapsin yfp navii iii construct - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid 3 × ere tata luciferase ![]() Plasmid 3 × Ere Tata Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid 3 × ere tata luciferase/product/Addgene inc Average 93 stars, based on 1 article reviews
plasmid 3 × ere tata luciferase - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: eLife
Article Title: Fan cells in lateral entorhinal cortex directly influence medial entorhinal cortex through synaptic connections in layer 1
doi: 10.7554/elife.83008
Figure Lengend Snippet: Figure 1. Fan cells in lateral entorhinal cortex send projections to medial entorhinal cortex that terminate in layer 1. (A) Schematic of strategy for targeting AAV-Retro-mCherry to the medial entorhinal cortex (MEC) of wild-type mice (top) and a horizontal brain section (bottom) showing retrograde labelling of neurons with mCherry in layers (L) 2a and 5a of lateral entorhinal cortex (LEC). Scale bar represents 500 µm. (B) Schematic of strategy for targeting AAV-FLEX-GFP to fan cells in Sim1Cre mice (top) and horizontal brain section (bottom) showing labelling of fan cell axons with GFP (green) in the outer molecular layer (oml) of the dentate gyrus (DG) and L1 of the MEC. Neurons are counterstained with Neurotrace (blue). Scale bar represents 500 µm. (C) Schematic of strategy for targeting AAV-FLEX-GFP-2A-Synaptophysin-mRuby to fan cells in Sim1Cre mice (top) and horizontal brain section (bottom) showing fan cell axons (green) and their terminals (red) in L1 and L2 of the MEC. Insets show synaptic puncta, indicated by white arrows. Scale bar represents 50 µm. (D) Line plots showing the volumetric density of axon terminals across L1-5b (left) and the mediolateral axis of the MEC (right). The mediolateral (M-L) axis of MEC was binned in 150 µm steps from the parasubiculum border. Black line shows population averages, and grey circles are values for single brain slices. Error bars represent SEM. There was a significant effect of MEC layer (Χ2 (4)=32.8, p=0.000001, Kendall W=0.745, Friedman test) and location (Χ2 (5)=21.6, p=0.0006, Kendall W=0.394) on puncta density. There was a higher density of puncta in L1 (4790±545 mm3) compared to all other layers (L2: W=66, p=0.01; L3: W=66, p=0.01; L5a: W=66, p=0.01; L5b: W=66, p=0.01, pairwise Wilcoxon tests with Bonferroni correction) and a
Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (mouse) Sim1Cre Gen- Sat, MMRC RRID: MMRRC_034614-UCD NA Chemical compound, drug Biocytin Sigma- Aldrich B4261 Biotin- lysine compound used for neuron reconstruction Chemical compound, drug Gabazine Hello Bio HB0901 GABAA receptor antagonist, diluted to 10 μM Chemical compound, drug CGP55845 Hello Bio HB0960 GABAB receptor antagonist,diluted to 100 μM Chemical compound, drug D- AP5 Hello Bio HB0225 NMDA receptor antagonist, diluted to 50 μM Chemical compound, drug NBQX disodium salt Hello Bio HB0442 AMPA receptor antagonist, diluted to 10 μM Chemical compound, drug Tetrodotoxin Hello Bio HB1034 Na +channel- blocker, diluted to 500 nM Chemical compound, drug 4- Aminopyridine (AP) Hello Bio HB1073 Kv channel- blocker, diluted to 200 μM Software, algorithm R NA Version: 3.6.0 https://www.r-project.org/ Software, algorithm Matlab Mathworks Version: 2013 a https://www.mathworks.com Software, algorithm Igor Pro Wavemetrics Version: 6.3 https://www.wavemetrics.com/ Software, algorithm AxoGraph AxoGraph Version 1.7.6 https://www.axograph.com Software, algorithm ImageJ Fiji NA https://fiji.sc Other (Stains) AlexaFluor Streptavidin 647 Invitrogen Cat #: S21374 1:500 dilution, biotin- binding Other (
Techniques:
Journal: eLife
Article Title: Fan cells in lateral entorhinal cortex directly influence medial entorhinal cortex through synaptic connections in layer 1
doi: 10.7554/elife.83008
Figure Lengend Snippet: Figure 2. Projections to the medial entorhinal cortex from lateral entorhinal cortex arise from fan cells that also send projections to the hippocampus. (A) Schematic of strategy for targeting GFP specifically to fan cells in the lateral entorhinal cortex (LEC) that project to the hippocampal dentate gyrus (DG). In a wild-type mouse, adeno-associated virus (AAV) encoding retrograde Cre (AAV-Retro-Cre, grey) was injected into the DG and Cre-dependent AAV encoding GFP (AAV-FLEX-GFP, green) was injected into the LEC. (B) Horizontal brain section from a wild-type mouse showing GFP labelling of fan cell axons (green) in the outer molecular layer (oml) of the DG and layer (L) 1 of the medial entorhinal cortex (MEC). Neurons are counterstained with Neurotrace (red). Scale bar represents 500 µm. (C) Horizontal brain section from the same mouse shown in B, showing retrograde labelling of fan cell bodies with GFP (green) in L2a of the LEC. Scale bar represents 100 µm. (D) Fluorescence intensity of fan cell axons in L1 of MEC and the oml of DG. Intensity was quantified as the mean gray value of pixels in regions of interest (ROIs), where the possible range of values was 1–255 and a value of 255 corresponds to white. Mean intensity values were quantified for ROIs in MEC and DG, and were adjusted to baseline by subtracting the intensity value of an ROI from the same slice that did not contain fan cell axons. Fluorescence intensities were similar for DG and MEC (W=4, p=1, Mann Whitney U test). Black line shows the population average and grey circles are values for single brain slices. Error bars are SEM. (E) Fluorescence intensity as a function of distance across layers of MEC (top) and DG (bottom). For MEC, intensity was sampled from the edge of the slice (L1) towards the hippocampus. For DG, intensity was sampled from the outer edge of the oml towards the hilus. Plots are normalised to the minimum and maximum intensity values. Black line is a polynomial fit to the population data, and gray lines are values for single brain slices. (F) The dorsal-ventral position of the horizontal sections was estimated relative to bregma (top). Epifluorescent images of horizontal brain sections show GFP expression at dorsoventral locations containing the MEC and extending to the injection site in LEC. Zoomed in images of the ROIs highlighted by boxes in the left panels are shown in the panels to the right. Numbers indicate depth of slice from bregma in mm. Scale bar represents 500 µm. (G) Confocal images of a horizontal
Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (mouse) Sim1Cre Gen- Sat, MMRC RRID: MMRRC_034614-UCD NA Chemical compound, drug Biocytin Sigma- Aldrich B4261 Biotin- lysine compound used for neuron reconstruction Chemical compound, drug Gabazine Hello Bio HB0901 GABAA receptor antagonist, diluted to 10 μM Chemical compound, drug CGP55845 Hello Bio HB0960 GABAB receptor antagonist,diluted to 100 μM Chemical compound, drug D- AP5 Hello Bio HB0225 NMDA receptor antagonist, diluted to 50 μM Chemical compound, drug NBQX disodium salt Hello Bio HB0442 AMPA receptor antagonist, diluted to 10 μM Chemical compound, drug Tetrodotoxin Hello Bio HB1034 Na +channel- blocker, diluted to 500 nM Chemical compound, drug 4- Aminopyridine (AP) Hello Bio HB1073 Kv channel- blocker, diluted to 200 μM Software, algorithm R NA Version: 3.6.0 https://www.r-project.org/ Software, algorithm Matlab Mathworks Version: 2013 a https://www.mathworks.com Software, algorithm Igor Pro Wavemetrics Version: 6.3 https://www.wavemetrics.com/ Software, algorithm AxoGraph AxoGraph Version 1.7.6 https://www.axograph.com Software, algorithm ImageJ Fiji NA https://fiji.sc Other (Stains) AlexaFluor Streptavidin 647 Invitrogen Cat #: S21374 1:500 dilution, biotin- binding Other (
Techniques: Virus, Injection, Fluorescence, MANN-WHITNEY, Expressing
Journal: eLife
Article Title: Fan cells in lateral entorhinal cortex directly influence medial entorhinal cortex through synaptic connections in layer 1
doi: 10.7554/elife.83008
Figure Lengend Snippet: Figure 3. Fan cells that project to medial entorhinal cortex receive inputs from piriform and prefrontal cortices (A-B) (Top). Schematic of strategy for targeting GFP specifically to fan cells in the lateral entorhinal cortex (LEC) that receive projections from piriform cortex (PIR, A) or medial prefrontal cortex (mPFC, B). AAV that anterogradely transports Cre (pENN-AAV-hSyn-Cre-WPRE, grey) was injected into the PIR or mPFC of a wild-type mouse. Cre-dependent AAV encoding GFP (AAV-FLEX-GFP, green) was injected into the LEC of the same mouse to label Cre-expressing fan cells and their axons. Horizontal brain section showing labelling of fan cell axons with GFP in the outer molecular layer (oml) of the dentate gyrus (DG) and layer (L) 1 of the MEC (right panels show zoomed in images of the regions of interest highlighted in the left panels). Scale bar is 500 µm. (C) Expression of GFP in fan cells at the injection site in the same animal as A. Neurons are counterstained with Neurotrace (red). (D) Fluorescence intensity in L1 of MEC and the oml of DG of axons from fan cells receiving inputs from PIR. The fluorescence intensity of fan cell axons was higher in the DG (W=16, p=0.029, Mann Whitney U test). Black line shows population average and grey circles are values for single brain slices. Error bars are SEM. (E) Fluorescence intensity of axons from fan cells that receive PIR inputs as a function of distance across layers of MEC (left) and DG (right). For MEC, intensity was sampled from the edge of the slice (L1) towards the hippocampus. For DG, intensity was sampled from the outer edge of the oml towards the hilus. ROIs were oriented perpendicular to the layers of MEC and DG. Plots are normalised to the minimum and maximum intensity values. Black line is population data fit with a polynomial model and gray lines are values for single brain slices. (F) Same as C but for fan cells labelled on the basis of receiving projections from medial prefrontal cortex (mPFC). (G-H) Same as (D-E), but for axons from fan cells that receive inputs for mPFC. Fluorescence intensities of axons from fan cells that receive inputs from mPFC was similar for DG and MEC (W=12, p=0.343).
Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (mouse) Sim1Cre Gen- Sat, MMRC RRID: MMRRC_034614-UCD NA Chemical compound, drug Biocytin Sigma- Aldrich B4261 Biotin- lysine compound used for neuron reconstruction Chemical compound, drug Gabazine Hello Bio HB0901 GABAA receptor antagonist, diluted to 10 μM Chemical compound, drug CGP55845 Hello Bio HB0960 GABAB receptor antagonist,diluted to 100 μM Chemical compound, drug D- AP5 Hello Bio HB0225 NMDA receptor antagonist, diluted to 50 μM Chemical compound, drug NBQX disodium salt Hello Bio HB0442 AMPA receptor antagonist, diluted to 10 μM Chemical compound, drug Tetrodotoxin Hello Bio HB1034 Na +channel- blocker, diluted to 500 nM Chemical compound, drug 4- Aminopyridine (AP) Hello Bio HB1073 Kv channel- blocker, diluted to 200 μM Software, algorithm R NA Version: 3.6.0 https://www.r-project.org/ Software, algorithm Matlab Mathworks Version: 2013 a https://www.mathworks.com Software, algorithm Igor Pro Wavemetrics Version: 6.3 https://www.wavemetrics.com/ Software, algorithm AxoGraph AxoGraph Version 1.7.6 https://www.axograph.com Software, algorithm ImageJ Fiji NA https://fiji.sc Other (Stains) AlexaFluor Streptavidin 647 Invitrogen Cat #: S21374 1:500 dilution, biotin- binding Other (
Techniques: Injection, Expressing, Fluorescence, MANN-WHITNEY
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 expression in a model of osteoarthritis was downregulated. Heat map (A), GO-BP enrichment analysis for PRDX3 (B), PRDX3 mRNA expression in patients with OA; PRDX3 mRNA and protein expression (D and E) in mice model with OA; Single-cell analysis revealed that the PRDX3 gene was expressed in bone cells in patients with OA (F); ** P < .01 vs normal or sham. OA, osteoarthritis.
Article Snippet: SW982 cells were transfected with
Techniques: Expressing, Single-cell Analysis
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: Sh-PRDX3 promoted osteoarthritis cartilage injury in mice models through the induction of oxidative stress. Arthritis score (A), cartilage injury (HE staining, B), morphopathological changes score (C), index of hind paw edema (D), spleen index (E), ALP and MDA activity levels (F, G), SOD and GSH-PX activity levels (H, I) in models of OA by sh-PRDX3. # P < .05, ## P < .01, ### P < .001 vs arthritis.
Article Snippet: SW982 cells were transfected with
Techniques: Staining, Activity Assay
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 reduced oxidative stress in vitro model of osteoarthritis. PRDX3 mRNA expression (A, B) in an in vitro model of osteoarthritis; MDA, SOD, GSH-PX, ROS levels (C, D, E, F) in an in vitro model of osteoarthritis by si-PRDX3; MDA, SOD, GSH-PX, ROS levels (G, H, I, J) in the in vitro model of osteoarthritis by PRDX3. # P < .05, ## P < .01, ### P < .001 vs si-nc or negative.
Article Snippet: SW982 cells were transfected with
Techniques: In Vitro, Expressing
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 reduced ferroptosis in an in vitro model or mice model of osteoarthritis. Cell proliferation (A), LDH and PI levels (B, C), iron content (D), GSH activity level (E) in an in vitro model of osteoarthritis by PRDX3; Cell proliferation (F), LDH and PI levels (G, H), iron content (I), GSH activity level (J) in an in vitro model of osteoarthritis by Si-PRDX3; Dead cell rate in vitro model of osteoarthritis by Si-PRDX3 (K) or PRDX3 (L); GPX4 protein expression in an in vitro model of osteoarthritis by PRDX3 (M) or si-PRDX3 (N) or in a mice model of osteoarthritis by sh-PRDX3 (O). # P < .05, ## P < .01, ### P < .001 vs si-nc or negative or arthritis.
Article Snippet: SW982 cells were transfected with
Techniques: In Vitro, Activity Assay, Expressing
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 suppressed ROS accumulation and mitochondria-dependent ferroptosis in an in vitro model or mice model of osteoarthritis. JC-1 disaggregation (A), calcein-AM/CoCl2 (B), mitochondrial damage (C) in an in vitro model of osteoarthritis by PRDX3; JC-1 disaggregation (D), calcein-AM/CoCl2 (E), mitochondrial damage (F) in an in vitro model of osteoarthritis by si-PRDX3; ECAR level (G) and OCR levels (H) in an in vitro model of osteoarthritis by PRDX3; ECAR level (I) and OCR levels (J) in an in vitro model of osteoarthritis by si-PRDX3; ### P < .001 vs si-nc or negative.
Article Snippet: SW982 cells were transfected with
Techniques: In Vitro
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 induced SIRT3 expression level in a model of osteoarthritis. Heat map (A), GO-BP enrichment analysis for SIRT3 (B), result analysis for SIRT3 (C), PRDX3/SIRT3 protein expression (D, E) in mice model of osteoarthritis by sh-PRDX3; PRDX3/SIRT3 protein expression (F, G) in vitro model of osteoarthritis by PRDX3; PRDX3/SIRT3 protein expression (H, I) in vitro model of osteoarthritis by si-PRDX3; ## P < .01, ### P < .001 vs si-nc or negative or arthritis.
Article Snippet: SW982 cells were transfected with
Techniques: Expressing, In Vitro
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: SIRT3 regulated the effects of PRDX3 on oxidative stress in vitro model of osteoarthritis. SIRT3/GPX4 protein expression (A, B), GSH/SOD/GSH-PX/MDA/ROS levels (C, D, E, F, G) in an in vitro model of osteoarthritis by si-PRDX3+ SIRT3; SIRT3/GPX4 protein expression (H, I), GSH/SOD/GSH-PX/MDA/ROS levels (J, K, L, M, N) in an in vitro model of osteoarthritis by PRDX3+ SIRT3 inhibitor; ## P < .01, ### P < .001 vs si-nc or negative; * P < .05, ** P < .01 vs si-PRDX3 or PRDX3.
Article Snippet: SW982 cells were transfected with
Techniques: In Vitro, Expressing
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: SIRT3 regulated the effects of PRDX3 on ferroptosis in an in vitro model of osteoarthritis. Cell proliferation (A), LDH and PI levels (B, C), iron content (D), JC-1 disaggregation (E), calcein-AM/CoCl2 (F) in the in vitro model of osteoarthritis by PRDX3+ SIRT3 inhibitor; Cell proliferation (G), LDH and PI levels (H, I), iron content (J), JC-1 disaggregation (K), calcein-AM/CoCl2 (L) in the in vitro model of osteoarthritis by si-PRDX3 + SIRT3; ## P < .01, ### P < .001 vs si-nc or negative; * P < .05, ** P < .01 vs si-PRDX3 or PRDX3.
Article Snippet: SW982 cells were transfected with
Techniques: In Vitro
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: PRDX3 reduced SIRT3 ubiquitination in a model of osteoarthritis. PRDX3/SIRT3 expression (immunofluorescence, A); 3D structure for PRDX3 protein interlinking with SIRT3 protein (B); WT/Mutation site of PRDX3 or SIRT3 (C); IP assay for PRDX3 protein interlinking with SIRT3 protein (C); SIRT3 ubiquitination (D).
Article Snippet: SW982 cells were transfected with
Techniques: Ubiquitin Proteomics, Expressing, Immunofluorescence, Mutagenesis
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: METTL3-mediated m6A modification decreases PRDX3 mRNA stability in a model of osteoarthritis cartilage injury. Methylation modification sites near (A), PRDX3 mRNA expression (B), the stability of PRDX3 mRNA (C), PRDX3/METTL3 levels in patients with osteoarthritis (D), PRDX3/METTL14 levels in patients with osteoarthritis (E), 3′-untranslated region (UTR) of PRDX3 (F), m6A modification (G), luciferase activity level (H), modification (F), m6A modification by YTHDF1 (I). ## P < .01, ### P < .001.
Article Snippet: SW982 cells were transfected with
Techniques: Modification, Methylation, Expressing, Luciferase, Activity Assay
Journal: Archives of Rheumatology
Article Title: Methylation of PRDX3 Expression Alleviate Ferroptosis and Oxidative Stress in Patients with Osteoarthritis Cartilage Injury
doi: 10.5152/ArchRheumatol.2025.11031
Figure Lengend Snippet: Methylation of PRDX3 expression alleviate ferroptosis and oxidative stress in patients with osteoarthritis cartilage injury.
Article Snippet: SW982 cells were transfected with
Techniques: Methylation, Expressing